The detailed information of tRNA gene sequence


Sequence ID>WENV170623410
Genome IDFUWD013150272
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 429
End posion on genome 502
Amino Acid Arg
Anticodon TCG
Upstream region at tRNA start position
catatcctaa
tRNA gene sequence
GCACCCGTAGCTTAACTGGATAGAGCATCGGTCTTCGGAACCGAGGGTTGAGGGTTCGAA
TCCTTCCGGGTGCGtat
Downstream region at tRNA end position
aattgtgtta
Secondary structure (Cloverleaf model)
>WENV170623410	Arg	TCG
                   a      Gtat aattgtgtta
                     G - C
                     C - G
                     A - T
                     C - G
                     C - G
                     C - G
                     G - C          T A
                    T     C T T C C     A
      C A A        A      | | + | |     G
    T       T T C G       G A G G G     C
    G       + | | |                 T T
    G       G A G C
      A T A        A     GGGTT
                    T - A
                    C - G
                    G - C
                    G - C
                    T - A
                  C       A
                  T       G
                    T C G
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK