The detailed information of tRNA gene sequence


Sequence ID>WENV170628987
Genome IDFUWD013258108
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 14190
End posion on genome 14116
Amino Acid Val
Anticodon CAC
Upstream region at tRNA start position
aattcaagca
tRNA gene sequence
GGACTCATAGCTCAGTTGGCTAGAGCGCTGCATTCACATTGCAGAGGTCGAAGGTTCGAG
TCCTTCTGAGTCCACat
Downstream region at tRNA end position
aattacttaa
Secondary structure (Cloverleaf model)
>WENV170628987	Val	CAC
                   a      ACat aattacttaa
                     G - C
                     G - C
                     A - T
                     C - G
                     T - A
                     C - G
                     A - T          T G
                    T     C T T C C     A
      T G A        A      | | | | |     G
    T       C T C G       G A A G G     C
    G       | | | |                 T T
    G       G A G C
      C T A        G     AGGTC
                    C - G
                    T - A
                    G - C
                    C - G
                    A - T
                  T       T
                  T       A
                    C A C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK