The detailed information of tRNA gene sequence


Sequence ID>WENV170630768
Genome IDFUWD013323476
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 349
End posion on genome 275
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
aatacccaga
tRNA gene sequence
GCGGGTATAACTCAGTGGTAGAGTGCTAGCTTCCCAAGCTAATAGTCGCGAGTTCGAGTC
TCGTTACCCGCTCCA
Downstream region at tRNA end position
tctttatttt
Secondary structure (Cloverleaf model)
>WENV170630768	Gly	CCC
                   a      TCCA tctttatttt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     T - A
                     A - T          T G
                    T     T G C T C     A
        G A        A      + | | | |     G
      T     C T C A       G C G A G     C
      G     | | | |                 T T
      G     G A G T
        T A        G     TAGTC
                    C   A
                    T - A
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK