The detailed information of tRNA gene sequence


Sequence ID>WENV170631257
Genome IDFUWD013346463
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 1092
End posion on genome 1018
Amino Acid Ile
Anticodon TAT
Upstream region at tRNA start position
gcgtaaatac
tRNA gene sequence
GGGCGTATAGCTCAGTGGTAGAGCGCCACTCTTATAAAGTGGATGTCGCAGGTTCAAATC
CTGCTACGCCCACCT
Downstream region at tRNA end position
gagatttaaa
Secondary structure (Cloverleaf model)
>WENV170631257	Ile	TAT
                   c      ACCT gagatttaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     G - C
                     T - A
                     A - T          T A
                    T     C G T C C     A
        G A        A      | | | | |     A
      T     C T C G       G C A G G     C
      G     | | | |                 T T
      G     G A G C
        T A        G     ATGTC
                    C - G
                    C - G
                    A - T
                    C - G
                    T - A
                  C       A
                  T       A
                    T A T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK