The detailed information of tRNA gene sequence


Sequence ID>WENV170631512
Genome IDFUWD013355334
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 5012
End posion on genome 5085
Amino Acid Gly
Anticodon CCC
Upstream region at tRNA start position
ggaggaataa
tRNA gene sequence
GCGGGATTAGTATAGTGGCAATACGCTAGCTTCCCAAGCTATAAACGCGAGTTCGATTCT
CGTATCCCGCTCCA
Downstream region at tRNA end position
tgaactattt
Secondary structure (Cloverleaf model)
>WENV170631512	Gly	CCC
                   a      TCCA tgaactattt
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     T - A          T T
                    T     T G C T C     A
        G A        A      + | | | |     G
      T     T A T G       G C G A G     C
      G     | | | |                 T T
      G     A T A C
        C A        G     AAAC
                    C   T
                    T - A
                    A - T
                    G - C
                    C - G
                  T       A
                  T       A
                    C C C
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK