The detailed information of tRNA gene sequence


Sequence ID>WENV170631551
Genome IDFUWD013356780
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 494
End posion on genome 412
Amino Acid Tyr
Anticodon GTA
Upstream region at tRNA start position
ttggttcaga
tRNA gene sequence
GGGTAGGTACCGAAACGGTTAAACGGAGCAGACTGTAAATCTGCCGGCGTCGCCTTTGGA
GGTTCGAATCCTCCCCTGCCCACgg
Downstream region at tRNA end position
agaaacatct
Secondary structure (Cloverleaf model)
>WENV170631551	Tyr	GTA
                   a      ACgg agaaacatct
                     G - C
                     G - C
                     G - C
                     T + G
                     A - T
                     G - C
                     G - C          T A
                    T     C C T C C     A
      C A A        A      | | | | |     G
    G       A G C C       G G A G G     C
    G         | | |                 T T
    T       A C G G
      T A A        A     CGGCGTCGCCTTT
                    G - C
                    C - G
                    A - T
                    G - C
                    A - T
                  C       A
                  T       A
                    G T A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK