The detailed information of tRNA gene sequence


Sequence ID>WENV170631706
Genome IDFUWD013362492
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 929
End posion on genome 1002
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
taataatttt
tRNA gene sequence
GCGCCCGTAGCTCAGTTGGCAGAGCACCAGCCTTTTAAGCTGTGGGTCGTGGGTTCAAGT
CCCTCCGGGCGCACat
Downstream region at tRNA end position
ttttttaggc
Secondary structure (Cloverleaf model)
>WENV170631706	Lys	TTT
                   t      ACat ttttttaggc
                     G - C
                     C - G
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C          T G
                    T     C T C C C     A
      T G A        A      |   | | |     A
    T       C T C G       G T G G G     C
    G       | | | |                 T T
    G       G A G C
      C A          A     GGGTC
                    C   T
                    C - G
                    A - T
                    G - C
                    C - G
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK