The detailed information of tRNA gene sequence


Sequence ID>WENV170631863
Genome IDFUWD013368698
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 1047
End posion on genome 962
Amino Acid Leu
Anticodon TAA
Upstream region at tRNA start position
cctcaggaat
tRNA gene sequence
GCCCGGGTGATGAAACTGGTAAACATGCAACACTTAAAATGTTGTGAGCTCTGCTCTTGA
GGGTTCGAACCCCTCCCCGGGCACAA
Downstream region at tRNA end position
acgcaataaa
Secondary structure (Cloverleaf model)
>WENV170631863	Leu	TAA
                   t      ACAA acgcaataaa
                     G - C
                     C - G
                     C - G
                     C - G
                     G - C
                     G - C
                     G - C          C A
                    T     C T C C C     A
      C A A        G      | | | | |     G
    T       A G T A       G A G G G     C
    G         | | |                 T T
    G       A C A T
      T A A        G     TGAGCTCTGCTCTT
                    C - G
                    A - T
                    A - T
                    C - G
                    A - T
                  C       A
                  T       A
                    T A A
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK