The detailed information of tRNA gene sequence


Sequence ID>WENV170632413
Genome IDFUWD013381551
Search identical group
Phylum/Class[FUWD] metagenome; unknown
Species
Start position on genome 8189
End posion on genome 8265
Amino Acid Lys
Anticodon TTT
Upstream region at tRNA start position
gacacatcag
tRNA gene sequence
GGGCCGTTAGCTCAGCTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCAGGAGTTCAAA
TCTCCTACGGCCCACCA
Downstream region at tRNA end position
taaaatcaaa
Secondary structure (Cloverleaf model)
>WENV170632413	Lys	TTT
                   g      ACCA taaaatcaaa
                     G - C
                     G - C
                     G - C
                     C - G
                     C - G
                     G - C
                     T - A          T A
                    T     T C C T C     A
      C G A        A      | | | | |     A
    T       C T C G       A G G A G     C
    T       | | | |                 T T
    G       G A G C
      G T A        A     TGGTC
                    G + T
                    T - A
                    T - A
                    G - C
                    A - T
                  C       A
                  T       A
                    T T T
Intron
Comment/Decision
Genome/Seq. Info.[ENA]

Comment
---
Input Comment
E-mail
Comment
Input this 5 letters

Attention:
When your comment is judged as an irrelevant one by the administrator,
your comment will be deleted by the administrator.

BACK