| Sequence ID | >WENV170633099 | 
| Genome ID | FUWD013391325 | 
| Phylum/Class | [FUWD] metagenome; unknown | 
| Species | |
| Start position on genome | 346 | 
| End posion on genome | 272 | 
| Amino Acid | Gly | 
| Anticodon | GCC | 
| Upstream region at tRNA start position | acttcctaca | 
| tRNA gene sequence | GCGGGAATAGCTCAGTGGTAGAGCTCTACCTTGCCAAGGTAGACGTCGCGGGTTCGAATC | 
| Downstream region at tRNA end position | ttttttccgg | 
| Secondary structure (Cloverleaf model) | >WENV170633099	Gly	GCC
                   a      TCCA ttttttccgg
                     G - C
                     C - G
                     G - C
                     G - C
                     G - C
                     A - T
                     A - T          T A
                    T     T G C C C     A
        G A        A      + | | | |     G
      T     C T C G       G C G G G     C
      G     | | | |                 T T
      G     G A G C
        T A        T     ACGTC
                    C - G
                    T - A
                    A - T
                    C - G
                    C - G
                  T       A
                  T       A
                    G C C
 | 
| Intron | |
| Comment/Decision | |
| Genome/Seq. Info. | [ENA] | 
| Comment | |
| --- | |
| Input Comment |