Sequence ID | >WENV170643608 |
Genome ID | JMBV01000004 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 43320 |
End posion on genome | 43395 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
gatagggaaa |
tRNA gene sequence |
CGGAGCGTAGCGCAGTTGGGAGCGCGCCGGTCTTGGGCACCGGAGGTCGCTGGTTCAAAT |
Downstream region at tRNA end position |
tttttgttgc |
Secondary structure (Cloverleaf model) | >WENV170643608 Pro TGG a ACCA tttttgttgc C - G G - C G - C A - T G - C C - G G - C T A T T G A C C A T G A A + | | | | A T C G C G G C T G G C G | | | | T T G G C G C G A G AGGTC C - G C - G G - C G - C T - A C C T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |