Sequence ID | >WENV170643610 |
Genome ID | JMBV01000004 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 43504 |
End posion on genome | 43579 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ggccgctcca |
tRNA gene sequence |
GCGCCTGTAGCTCAAAGGATAGAGCATTGGATTTCTAATCCAAGGGCTGTGGGTTCGAGT |
Downstream region at tRNA end position |
atctttgttt |
Secondary structure (Cloverleaf model) | >WENV170643610 Arg TCT a ACCA atctttgttt G - C C - G G - C C - G C - G T - A G - C T G T C G C C C A A A A A | + | | | G G C T C G G T G G G C G | | | | T T A G A G C T A A GGGCT T - A T - A G - C G - C A - T T A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |