Sequence ID | >WENV170643612 |
Genome ID | JMBV01000004 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 60568 |
End posion on genome | 60496 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
tcacgatggc |
tRNA gene sequence |
CCCCCCATAGGATAATGGTTAGTCCATTGGATTCTCAGTCCAAGAGTCAGGGTTCGATTC |
Downstream region at tRNA end position |
ccaccccccc |
Secondary structure (Cloverleaf model) | >WENV170643612 Glu CTC c GCtg ccaccccccc C - G C - G C - G C - G C - G C - G A - T T T T G T C C C A T A A A | | | | | G G T A G G C A G G G C G + | | | T T T G T C C T A A GAGT T - A T - A G - C G - C A - T T G T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |