Sequence ID | >WENV170643615 |
Genome ID | JMBV01000007 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 14510 |
End posion on genome | 14587 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
atcactgcaa |
tRNA gene sequence |
GCGCCTATAGCTCAGGGGGGGATAGAGCACCGGCCTCCGGAGCCGGGAGCGCAGGTTCGA |
Downstream region at tRNA end position |
tttgtttttt |
Secondary structure (Cloverleaf model) | >WENV170643615 Arg CCG a GCCA tttgtttttt G - C C - G G - C C - G C - G T - A A - T T T T C G T C C A G G G A A | | | | | G G C T C G G C A G G C G | | | | T T G G A G C G A T A A GAGC C - G C - G G - C G - C C - G C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |