Sequence ID | >WENV170643618 |
Genome ID | JMBV01000008 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 81622 |
End posion on genome | 81695 |
Amino Acid | Gly |
Anticodon | CCC |
Upstream region at tRNA start position |
cattcacaat |
tRNA gene sequence |
GCGGCAATAGCTCAGTCGGTAGAGCATTAGCTTCCCAAGCTGAGGGTCGCGAGTTCGAAT |
Downstream region at tRNA end position |
ttaaaatcag |
Secondary structure (Cloverleaf model) | >WENV170643618 Gly CCC t TCac ttaaaatcag G - C C - G G - C G - C C - G A - T A - T T A T T G C T C A T G A A + | | | | G C C T C G G C G A G C G | | | | T T G G A G C T A A GGGTC T - A T + G A - T G - C C - G T A T A C C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |