Sequence ID | >WENV170643620 |
Genome ID | JMBV01000011 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 14465 |
End posion on genome | 14540 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
tttgccgggg |
tRNA gene sequence |
GGGCGAATAGCTCAGCTGGGAGAGCACCTGCCTTACAAGCAGGGGGTCACAGGTTCAAGT |
Downstream region at tRNA end position |
tgcggtagta |
Secondary structure (Cloverleaf model) | >WENV170643620 Val TAC g ACCA tgcggtagta G - C G - C G - C C - G G - C A - T A - T T G T T G T C C A C G A A | | | | | A T C T C G A C A G G C G | | | | T T G G A G C G A A GGGTC C - G C - G T - A G - C C - G C A T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |