Sequence ID | >WENV170643628 |
Genome ID | JMBV01000011 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 15159 |
End posion on genome | 15236 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
taagtcattg |
tRNA gene sequence |
TGCCCCATCGTCTAGCGGCCTAGGACACCGCCCTTTCACGGCGAAGGCACCGGTTCAAAT |
Downstream region at tRNA end position |
ttttacgggc |
Secondary structure (Cloverleaf model) | >WENV170643628 Glu TTC g ACCA ttttacgggc T T G G C - G C - G C - G C - G A G C C T G T T G G T C G A C | + + + + A G T C T G C G G T T A G + | | | C A C G G A C C T A A AGGCAC C A C - G G - C C - G C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |