Sequence ID | >WENV170643630 |
Genome ID | JMBV01000011 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 78625 |
End posion on genome | 78710 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
aaataggcgt |
tRNA gene sequence |
GGAGGGATACCCAAGCTGGCCAAAGGGGGCAGACTGTAAATCTGCTGGCAGTGCCTTCAC |
Downstream region at tRNA end position |
tcattttcaa |
Secondary structure (Cloverleaf model) | >WENV170643630 Tyr GTA t ACCA tcattttcaa G - C G - C A - T G - C G - C G - C A - T T A T T G T C C A T C G A A | | | | | G G A C C C A C A G G C G | | | T T C A G G G C A A G TGGCAGTGCCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |