Sequence ID | >WENV170643631 |
Genome ID | JMBV01000011 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 78726 |
End posion on genome | 78806 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
tcaaacggcG |
tRNA gene sequence |
CGGGGGGGTGGAGCAGTCTGGTAGCTCGTCGGGCTCATAACCCGGAGGTTGTCGGTTCAA |
Downstream region at tRNA end position |
atttttcaaa |
Secondary structure (Cloverleaf model) | >WENV170643631 Met CAT G ACCA atttttcaaa C A G - C G G G - C G - C G - C G - C C C G C C C G G T T G A C T | | + + A C G A G G C G G T T A T + | C A G G C T C G T A G AGGTTGT T + G C - G G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |