Sequence ID | >WENV170643632 |
Genome ID | JMBV01000011 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 40839 |
End posion on genome | 40763 |
Amino Acid | Asp |
Anticodon | GTC |
Upstream region at tRNA start position |
ttgtagaagc |
tRNA gene sequence |
GGAGCCGTGGTGTAGCTGGTTAACACGTCGGCCTGTCACGCCGAAGATCGCGAGTTCGAA |
Downstream region at tRNA end position |
tttatgactg |
Secondary structure (Cloverleaf model) | >WENV170643632 Asp GTC c GCCA tttatgactg G - C G - C A - T G + T C - G C - G G - C T A T T G C T C A C G A G + | | | | G T T G T G G C G A G C G | | | | T T G A C A C T T A G AGATC T - A C - G G - C G - C C - G C C T A G T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |