Sequence ID | >WENV170643636 |
Genome ID | JMBV01000016 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 8967 |
End posion on genome | 8894 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
caaaattaaT |
tRNA gene sequence |
GTGCCTGTAGCCTAAAGGATAAAGCGTTGGACTCCGGATCCAAAGATGCGGGTTCGATTC |
Downstream region at tRNA end position |
ttattgtatt |
Secondary structure (Cloverleaf model) | >WENV170643636 Arg CCG T ATaa ttattgtatt G - C T - A G - C C - G C - G T - A G - C T T T C G C C C A A A A A | | | | | G G T C C G G C G G G C G | | | T T A A A G C T A G AGAT T - A T - A G - C G - C A - T C A T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |