Sequence ID | >WENV170643638 |
Genome ID | JMBV01000017 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 57116 |
End posion on genome | 57204 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atggttggcC |
tRNA gene sequence |
GGGGGGGTGGCGGAATGGTAGACGCTACGGACTTAAAATCCGTTGGGCTAATCGCCCGTG |
Downstream region at tRNA end position |
Atcttatgta |
Secondary structure (Cloverleaf model) | >WENV170643638 Leu TAA C CACC Atcttatgta G G G G G - C G - C G - C G - C G - C T G T C T C C C A T A A G | | | | | G G G G C G G A G G G C G | | | T T T A C G C A G T TGGGCTAATCGCCCGT A - T C - G G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |