Sequence ID | >WENV170643639 |
Genome ID | JMBV01000017 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 60850 |
End posion on genome | 60928 |
Amino Acid | Lys |
Anticodon | CTT |
Upstream region at tRNA start position |
catagtgcgt |
tRNA gene sequence |
GGGCCATTAGCTCAGTAGGTAGAGCACCTGACTCTTAATCAGGGCGTCCCCCCCGGTTCG |
Downstream region at tRNA end position |
tacatattac |
Secondary structure (Cloverleaf model) | >WENV170643639 Lys CTT t ACCA tacatattac G - C G - C G - C C - G C - G A - T T - A C T T G T G C C A T G A A | | | | G A C T C G C C C G G C G | | | | T T G G A G C T A A GCGTCCCC C - G C - G T - A G - C A - T C A T A C T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |