Sequence ID | >WENV170643644 |
Genome ID | JMBV01000022 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 45551 |
End posion on genome | 45475 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
acgaataaat |
tRNA gene sequence |
GCAGGCGTAGCTACAGCAGGTAGAGCGCCGCCTTGGTAAGGCGGAGGTCATGGGTTCGAG |
Downstream region at tRNA end position |
attgttatga |
Secondary structure (Cloverleaf model) | >WENV170643644 Thr GGT t TCCA attgttatga G - C C - G A - T G - C G - C C - G G - C C G T T A C C C A G A C A | | | | | G C A T C G A T G G G C A | | | T T G G A G C G T A G AGGTC C - G C - G G - C C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |