Sequence ID | >WENV170643652 |
Genome ID | JMBV01000031 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 19952 |
End posion on genome | 19877 |
Amino Acid | Glu |
Anticodon | TTC |
Upstream region at tRNA start position |
cctagcaagC |
tRNA gene sequence |
CCCCCCATCGTCTAGCGGTCTAGGACATTGGCCTTTCACGCCAAAGACACCAGTTCAAAT |
Downstream region at tRNA end position |
ccagttttta |
Secondary structure (Cloverleaf model) | >WENV170643652 Glu TTC C GGCg ccagttttta C - G C - G C - G C - G C - G C - G A - T T A T T G G T C A C G A C | | | | | A G T C T G A C C A G C G + | | | T T T G G A C C T A A AGAC T - A T - A G - C G - C C - G C C T A T T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |