Sequence ID | >WENV170643658 |
Genome ID | JMBV01000035 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 10953 |
End posion on genome | 11029 |
Amino Acid | Arg |
Anticodon | GCG |
Upstream region at tRNA start position |
tttattgtat |
tRNA gene sequence |
GTGCCTGTAGCTCAATTGGATAGAGCGTTGGACTGCGGATCCGGAGGTTGCCGGTTCAAA |
Downstream region at tRNA end position |
ctattttcta |
Secondary structure (Cloverleaf model) | >WENV170643658 Arg GCG t GCCA ctattttcta G - C T - A G - C C - G C - G T - A G - C T A T C G G C C A T A A A | | | | | A T C T C G G C C G G C G | | | | T T G G A G C A T A G AGGTT T + G T + G G - C G - C A - T C A T G G C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |