Sequence ID | >WENV170643661 |
Genome ID | JMBV01000045 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 14676 |
End posion on genome | 14764 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
acaggataac |
tRNA gene sequence |
GCCGAGATGGCGGAACTGGTAGACGCTGTGGACTTAAAATCCACTGGGTGGAGACACCCG |
Downstream region at tRNA end position |
ctttagtaat |
Secondary structure (Cloverleaf model) | >WENV170643661 Leu TAA c ACCA ctttagtaat G - C C - G C - G G - C A - T G - C A - T T T T C A G C C A C A A G | | | | | G T G G C G G T C G G C G | | | T T G A C G C T A G T TGGGTGGAGACACCCGT G - C T - A G - C G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |