Sequence ID | >WENV170643666 |
Genome ID | JMBV01000052 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 167 |
End posion on genome | 94 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gaccattttt |
tRNA gene sequence |
GCGGGTGTAGCTCAATGGTAGAGCACCGGCCTTCCAAGCCGGCTATGTGAGTTCGATTCT |
Downstream region at tRNA end position |
ttatcctttt |
Secondary structure (Cloverleaf model) | >WENV170643666 Gly TCC t TCCA ttatcctttt G - C C - G G - C G - C G - C T - A G - C T T T T A C T C A A A A + | | | | G T C T C G G T G A G C G | | | | T T G G A G C T A A CTAT C - G C - G G - C G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |