Sequence ID | >WENV170643669 |
Genome ID | JMBV01000065 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3102 |
End posion on genome | 3025 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
tttgcagacc |
tRNA gene sequence |
GAATTGTTAGCTCAGCTGGTTTAGAGCGCTGCCTTGACAGGGCAGAGGTCGCCGGTTCGA |
Downstream region at tRNA end position |
ccccgactgc |
Secondary structure (Cloverleaf model) | >WENV170643669 Val GAC c ACCC ccccgactgc G - C A - T A - T T - A T - A G - C T - A T A T C G G C C A T C G A A | | | | | G G C T C G G C C G G C G | | | | T T T G A G C T T A G AGGTC C - G T - A G - C C - G C - G T G T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |