Sequence ID | >WENV170643673 |
Genome ID | JMBV01000076 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 19571 |
End posion on genome | 19643 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
aaaccaataa |
tRNA gene sequence |
GCCCCCGTAGCTCAATGGATAGAGCGCCGGTCTTCTAAACCGTAGGTTCCGCGTTCGAGT |
Downstream region at tRNA end position |
actctttaat |
Secondary structure (Cloverleaf model) | >WENV170643673 Arg TCT a Gtgc actctttaat G G C - G C - G C - G C - G C - G G - C T G T G G C G C A T A A A | | | | | G G C T C G C C G C G C G | | | | T T A G A G C T A G AGGTT C T C - G G - C G - C T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |