Sequence ID | >WENV170643679 |
Genome ID | JMBV01000095 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 8722 |
End posion on genome | 8797 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
attgcgtatt |
tRNA gene sequence |
GGGCCCGTAGCTCAGTGGATAGAGCAATGGTCTCCTAAACCATGTGTCGGACGTTCGATT |
Downstream region at tRNA end position |
tcttaaatac |
Secondary structure (Cloverleaf model) | >WENV170643679 Arg CCT t GCCA tcttaaatac G - C G - C G - C C - G C - G C - G G - C T T T T C T G C A T G A A + | | | | G G C T C G G G A C G C G | | | | T T A G A G C T A A GTGTC A - T T - A G - C G - C T - A C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |