Sequence ID | >WENV170643684 |
Genome ID | JMBV01000099 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 18804 |
End posion on genome | 18713 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aatgattgcC |
tRNA gene sequence |
GGGGGGGTGGTGGAATTGGCAGACACGTATGGTTGAGGGCCATATGAGTATACGCACTCG |
Downstream region at tRNA end position |
aagaaagata |
Secondary structure (Cloverleaf model) | >WENV170643684 Leu GAG C ACCA aagaaagata G - C G G G G G - C G - C G - C G - C C C T C C C G C T T A A G | | | + G T G G T G G G G T T A G | | | C A G A C A C C A G G TGAGTATACGCACTCGTGC T - A A - T T - A G - C G - C T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |