Sequence ID | >WENV170643687 |
Genome ID | JMBV01000120 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6021 |
End posion on genome | 6097 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
taattgtggg |
tRNA gene sequence |
GGGCGATTAGCTCAGTTGGCTAGAGTGCCACGTTGACATCGTGGAGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
tagaaaaatc |
Secondary structure (Cloverleaf model) | >WENV170643687 Val GAC g ACCA tagaaaaatc G - C G - C G - C C - G G - C A - T T - A C G T T A A C C A T G A A + | | | | G T C T C G G T T G G C G | | | + T T G G A G T C T A G AGGTC C - G C - G A - T C - G G - C T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |