Sequence ID | >WENV170643706 |
Genome ID | JMBV01000201 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 21305 |
End posion on genome | 21381 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
ttaatatgtg |
tRNA gene sequence |
GTGGATGTGGCCTAGTTGGTTAGGGCGCCAGATTGTGGCTCTGGAGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
ttatattttt |
Secondary structure (Cloverleaf model) | >WENV170643706 His GTG g CCCA ttatattttt G - C T - A G - C G - C A - T T - A G - C T A T T A C C C A T G A G + | | | | G T T C C G G T G G G C G + | | | T T G G G G C T T A G AGGTC C - G C - G A - T G - C A - T T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |