Sequence ID | >WENV170643707 |
Genome ID | JMBV01000201 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 21396 |
End posion on genome | 21471 |
Amino Acid | Lys |
Anticodon | TTT |
Upstream region at tRNA start position |
atttttaaat |
tRNA gene sequence |
GACCCATTAGCTCAGGCGGTAGAGCACCTGACTTTTAATCAGGGAGTCCGGCGTTCGAGT |
Downstream region at tRNA end position |
ccttttaatt |
Secondary structure (Cloverleaf model) | >WENV170643707 Lys TTT t ACCA ccttttaatt G - C A - T C - G C - G C - G A - T T - A T G T G C C G C A G G A A | | | | | G C C T C G C G G C G C G | | | | T T G G A G C T A A GAGTC C - G C - G T - A G - C A - T C A T A T T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |