Sequence ID | >WENV170643709 |
Genome ID | JMBV01000202 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 14421 |
End posion on genome | 14493 |
Amino Acid | Glu |
Anticodon | CTC |
Upstream region at tRNA start position |
catacaagaa |
tRNA gene sequence |
GGCGCACTCTTCTAACGGTTAGGAAAATTGTTTCTCAGGCAATGAATAGCGGTTCGATTC |
Downstream region at tRNA end position |
tcgaaactta |
Secondary structure (Cloverleaf model) | >WENV170643709 Glu CTC a ACtt tcgaaactta G + T G - C C - G G - C C - G A - T C - G T T T T C G C C A C A A C | | | | | G G T C T T A G C G G C G + | | | T T T G G A A T A A GAAT A - T T - A T - A G - C T + G T G T A C T C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |