Sequence ID | >WENV170643717 |
Genome ID | JMBV01000242 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 19375 |
End posion on genome | 19449 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
gcgttctacC |
tRNA gene sequence |
TTCCTGGTAGCTCAATCGGCAGAGCGGGCGGCTGTTAACCGCTAGGTTAGAGGTTCGAGT |
Downstream region at tRNA end position |
ccttcggaca |
Secondary structure (Cloverleaf model) | >WENV170643717 Asn GTT C GGag ccttcggaca T + G T + G C - G C - G T + G G - C G - C T G T T C T C C A T A A A | | | | | G C C T C G A G A G G C G | | | | T T G G A G C C A G AGGTT G + T G - C C - G G - C G - C C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |