Sequence ID | >WENV170643720 |
Genome ID | JMBV01000257 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 10 |
End posion on genome | 87 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
aaatattacG |
tRNA gene sequence |
GTGGGTATAGCTCAGTTGGTTAGAGCGCCAGGTTGTGGCCCTGGAGGTCGCCGGTTCGAA |
Downstream region at tRNA end position |
ccattaaaaa |
Secondary structure (Cloverleaf model) | >WENV170643720 His GTG G CCCC ccattaaaaa G - C T - A G - C G + T G - C T - A A - T T A T T G G C C A T G A A + | | | | G T C T C G G C C G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G A - T G - C G - C T C T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |