Sequence ID | >WENV170643726 |
Genome ID | JMBV01000261 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 16426 |
End posion on genome | 16351 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
cagggtttat |
tRNA gene sequence |
ACGGGTCTAGCTCAGTCGGTAGAGCACTGGTCTCCAAAACCAGGTGTCGGGAGTTCGAGT |
Downstream region at tRNA end position |
aacgatccga |
Secondary structure (Cloverleaf model) | >WENV170643726 Trp CCA t GCAA aacgatccga A - T C - G G - C G - C G - C T - A C - G T G T C T C T C A T G A A | + | | | G C C T C G G G G A G C G | | | | T T G G A G C T A A GTGTC C - G T - A G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |