Sequence ID | >WENV170643727 |
Genome ID | JMBV01000266 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 13054 |
End posion on genome | 13126 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
agtcttatac |
tRNA gene sequence |
GGCGCGGTAGTTCAATGGATAGAATAGAAGTTTCCTAAACTTTAGATCCGGGTTCGATTC |
Downstream region at tRNA end position |
tgaattaagc |
Secondary structure (Cloverleaf model) | >WENV170643727 Arg CCT c ACtt tgaattaagc G + T G - C C - G G + T C - G G - C G - C T T T G G C C C A T A A A | | | | | G G C T T G C C G G G C G | | | + T T A G A A T T A A AGAT G + T A - T A - T G - C T - A T A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |