Sequence ID | >WENV170643728 |
Genome ID | JMBV01000275 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3162 |
End posion on genome | 3238 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aattttcttt |
tRNA gene sequence |
GCCGGCGTAGCTCAACGGAAGAGCGGCTCATTCGTAATGAGTAGGTTGGGGGGGTTCAAA |
Downstream region at tRNA end position |
acaatttaaa |
Secondary structure (Cloverleaf model) | >WENV170643728 Thr CGT t TCCA acaatttaaa G - C C - G C - G G - C G - C C - G G - C T A T T T C C C A A A A + + | | | A C C T C G G G G G G C G | | | | T T G G A G C A A G AGGTTGG G + T C - G T - A C - G A - T T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |