Sequence ID | >WENV170643731 |
Genome ID | JMBV01000289 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6401 |
End posion on genome | 6326 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
aataaaacat |
tRNA gene sequence |
CGCGGAGTGGAGCAGTTGGTAGCTCGTTGGGCTCATAACCCAAAGGTCGTAAGTTCGAGT |
Downstream region at tRNA end position |
tcgaagaggg |
Secondary structure (Cloverleaf model) | >WENV170643731 Met CAT t ACTA tcgaagaggg C A G - C C - G G - C G - C A - T G - C T G T C A T T C A T G A G | | | | | G T C G A G G T A A G C G | | | | T T G G C T C T A G AGGTC T - A T - A G - C G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |