Sequence ID | >WENV170643733 |
Genome ID | JMBV01000306 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 16920 |
End posion on genome | 16845 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
ataaatataa |
tRNA gene sequence |
GTACCCATAGCTCAATTGGATAGAGTGCTTGACTACGAATCAAGAGGTTGGGGGGGTTCG |
Downstream region at tRNA end position |
atatgaggcc |
Secondary structure (Cloverleaf model) | >WENV170643733 Arg ACG a Attg atatgaggcc G - C T - A A - T C - G C - G C - G A - T C T T C C T C C A T A A A | | + | | G T C T C G G G G G G C G | | | + T T G G A G T A T A G AGGTTGG C - G T - A T - A G - C A - T C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |