Sequence ID | >WENV170643735 |
Genome ID | JMBV01000320 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7574 |
End posion on genome | 7482 |
Amino Acid | Ser |
Anticodon | CGA |
Upstream region at tRNA start position |
ttcataatac |
tRNA gene sequence |
GGAGAGATGTCTGAGTGGCTGAAAGTGGCGGTCTCGAAAACCGTTGCACAAGCGAACCTT |
Downstream region at tRNA end position |
aaaaaaataa |
Secondary structure (Cloverleaf model) | >WENV170643735 Ser CGA c GCCA aaaaaaataa G - C G - C A - T G - C A - T G - C A - T T A T C T C C C A T G A G | | | | | A G G T C T G A G G G C G | | T T C A A G T T G A G TGCACAAGCGAACCTTGTGCC G + T C - G G - C G - C T - A C A T A C G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |