Sequence ID | >WENV170643737 |
Genome ID | JMBV01000337 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 3450 |
End posion on genome | 3376 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
tttataaatg |
tRNA gene sequence |
GTGCATGTAGCTCAGTCGGTTAGAGCATTGGATTGTGGTTCCAAGGGTCGTGGGTTCGAG |
Downstream region at tRNA end position |
ttaacctttc |
Secondary structure (Cloverleaf model) | >WENV170643737 His GTG g CCtt ttaacctttc G - C T - A G - C C - G A - T T T G - C T G T T A C C C A T G A A + | | | | G C C T C G G T G G G C G | | | | T T G G A G C T T A A GGGTC T - A T - A G - C G - C A - T T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |