Sequence ID | >WENV170643739 |
Genome ID | JMBV01000359 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6067 |
End posion on genome | 6155 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
aattgtagga |
tRNA gene sequence |
GCAGGACTGGCGGAATTGGCAGACGCACTATCTTGAGGGGGGGGTAGCGGTCAACGACCA |
Downstream region at tRNA end position |
cataatatta |
Secondary structure (Cloverleaf model) | >WENV170643739 Leu GAG a ACCA cataatatta G - C C - G A - T G - C G - C A - T C - G T A T T G C T C A T A A G | | | | | G T G G C G A C G A G C G | | | T T G A C G C C A G A TAGCGGTCAACGACCAT C - G T + G A G T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |