Sequence ID | >WENV170643740 |
Genome ID | JMBV01000369 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 2125 |
End posion on genome | 2197 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
attaaaccct |
tRNA gene sequence |
GCACCCGTAGTTCAATGGATAGAATACCGGATTCCGGTTCCGACGATGTGGGTTCGATTC |
Downstream region at tRNA end position |
gaagcaaacc |
Secondary structure (Cloverleaf model) | >WENV170643740 Arg CCG t ACtt gaagcaaacc G + T C - G A - T C - G C - G C - G G - C T T T C G C C C A T A A A | + | | | G G C T T G G T G G G C G | | | + T T A G A A T T A A CGAT C A C - G G - C G - C A - T T T T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |