Sequence ID | >WENV170643741 |
Genome ID | JMBV01000373 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 5406 |
End posion on genome | 5334 |
Amino Acid | Gln |
Anticodon | TTG |
Upstream region at tRNA start position |
taatcgtccc |
tRNA gene sequence |
TGGGGTATTGTGTAATGGTAGCACACCGGACTTTGAATCCGTTTGTCGTGGTTCGAATCC |
Downstream region at tRNA end position |
cctagttatt |
Secondary structure (Cloverleaf model) | >WENV170643741 Gln TTG c CCAg cctagttatt T C G - C G - C G - C G - C T - A A - T T A T G T A C C A A A T | + | | | G T T G T G C G T G G C G + | | | T T G G C A C T A A TTGT C T C - G G - C G - C A - T C A T A T T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |