Sequence ID | >WENV170643744 |
Genome ID | JMBV01000416 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 6034 |
End posion on genome | 5959 |
Amino Acid | Val |
Anticodon | CAC |
Upstream region at tRNA start position |
gctacacttT |
tRNA gene sequence |
GGGCGCTTAGCTCAGTTGGTTAGAGCGCACGGTTCACATCCGTGAGGTCACTGGTTCGAG |
Downstream region at tRNA end position |
ttaccactct |
Secondary structure (Cloverleaf model) | >WENV170643744 Val CAC T ATtt ttaccactct G - C G - C G - C C - G G + T C - G T - A T G T T G A C C A T G A A | | | | | G T C T C G A C T G G C G | | | | T T G G A G C T T A G AGGTC C - G A - T C - G G - C G - C T T T A C A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |