Sequence ID | >WENV170643746 |
Genome ID | JMBV01000444 |
Phylum/Class | [JMBV] anaerobic digester metagenome; mesophilic anaerobic digester inoculated with municipal waste water sludge and fed with |
Species | |
Start position on genome | 7009 |
End posion on genome | 6932 |
Amino Acid | Trp |
Anticodon | CCA |
Upstream region at tRNA start position |
ttgctttgat |
tRNA gene sequence |
ACGCCTGTAGCTCAACTGGCAGAGCGGCGGTCTCCAAAACCGCAGGCTGGGGGGGTTCGA |
Downstream region at tRNA end position |
attttgtata |
Secondary structure (Cloverleaf model) | >WENV170643746 Trp CCA t GCCA attttgtata A - T C - G G - C C - G C - G T + G G - C T T T C T C C C A C A A A | + | | | G T C T C G G G G G G C G | | | | T T G G A G C C A G AGGCTGG G - C C - G G - C G - C T - A C A T A C C A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |